Використання методу полімеразної ланцюгової реакції реального часу для оцінки таксономічного складу мультикомпонентних пробіотиків

pcr

В.О. Кітам, Д.С. Янковський, В.П. Широбоков, Г.С. Димент, О.В. Літовченко, Л.М. Шевченко, Т.В. Шевченко

Вступ

Створення та виробництво мультикомпонентних пробіотиків потребує постійного якісного та кількісного контролю їх складу. Стандартні мікробіологічні підходи, такі як виділення окремих культур та ідентифікація їх таксономічного положення на основі вивчення морфологічних та біохімічних властивостей не завжди дають можливість точно оцінити вміст представників різних мікробних таксонів в складі мультисимбіозу. Крім того такі методи є в значній мірі часо- та працезатратними. Використання сучасних методів заснованих на детекції та ідентифікації послідовностей ДНК із використанням полімеразної ланцюгової реакції (ПЛР), а особливо її модифікації – кількісної полімеразної ланцюгової реакції в реальному часі (ПЛР-РЧ) дозволяє значно прискорити не лише таксономічну ідентифікацію але й кількісний аналіз складових мультисимбіозів.

Однією з умов проведення точної кількісної оцінки мікробіологічного складу різноманітних кисломолочних продуктів, а також мультисимбіозів, що культивуються на молоковмісних поживних середовищах, є чистота виділеної ДНК та відсутність в ній інгібіторів полімеразної ланцюгової реакції. Так наявність в зразках протеаз, іонів кальцію (Ca2+) та різноманітних полісахаридів [1] значно ускладнює, а подекуди й унеможливлює проведення реакції.

Нещодавно авторами розроблена нова серія мультикомпонентних пробіотиків «Симбітер форте», що містять, крім пробіотичної біомаси, гель смектиту (бентоніту) [2-4]. Висока адсорбційна активність смектиту є додатковим фактором, що ускладнює реалізацію методу.

В ході роботи нами було розроблено методику якісної та кількісної оцінки таксономічного складу мультикомпонентних симбіозів пробіотичних бактерій, що складають основу полівидових пробіотиків, у тому числі мультипробіотиків «Симбітер форте-М» (https://symbiter.ua/uk/multiprobiotics-symbiter-ua/symbiter-forte-m-ua.html), «Симбітер форте омега» (https://symbiter.ua/uk/multiprobiotics-symbiter-ua/symbiter-forte-omega-ua.html) та «Симбітер форте з прополісом» (https://symbiter.ua/uk/multiprobiotics-symbiter-ua/symbiter-forte-with-propolis-ua.html) (виробник НВК «О.Д. Пролісок»). Для цього було модифіковано метод виділення та очищення ДНК з бактеріальних клітин з урахуванням високого вмісту полісахаридів, смектиту та інших інгібіторів ПЛР в зразках, а також розроблено метод кількісної оцінки видового складу мультипробіотиків методом «ПЛР-реального часу» [6].

Матеріали та методи

Для виділення ДНК бактеріальні клітини попередньо відмивали від залишків казеїну, іонів кальцію, смектиту та екзополісахаридів. Для цього вміст одного пакету/саше мультипробіотику розводили у співвідношенні 2:3 0.1н розчином NaOH та відбирали 450 мкл зразку з подальшим центрифугуванням на протязі 10 хв при 10 тис. об/хв. (MiniSpin Eppendorf, Німеччина). Надалі отриманий осад розводили в 0,5 мл ТЕ-буфера (рН 8,0) і так само центрифугували. Відмитий осад знову розводили 250 мкл ТЕ-буферу (рН 8,0) із додаванням лізоциму у співвідношенні 5 мкг на 1 мл буферу та інкубували в термостаті 1 годину при 37°С. Лізис бактеріальних клітин проводили додаючи 0,5 мл лізисного буферу BQ1 (Macherey-Nagel, Німеччина) та інкубуючи в термостаті 1 годину при 70°С. Надалі додавали до пробірок рівний об’єм хлороформу та залишали на 15 хв час від часу м’яко перемішуючи. Розподіл фаз проводили центрифугуванням 10 хв при 10 тис. об/хв. Верхню прозору фазу обережно відбирали в чисту пробірку, додавали рівний об’єм ізопропанолу, ретельно перемішували, інкубували 15 хв при кімнатній температурі та центрифугували 10 хв при 10 тис. об/хв. Осад послідовно промивали за допомогою 100% та 70% розчинів етилового спирту відповідно центрифугуючи 10 хв при 10 тис. об/хв. Промитий осад надалі висушували та зберігали при -20°С, розводячи в 200мкл ТЕ-буферу безпосередньо перед аналізом.

Праймери підбирали за допомогою програми PrimerBlast (http://www.ncbi.nlm.nih.gov/tools/primer-blast) згідно правил молекулярного дизайну, базуючись на даних повного секвенування геномів, взятих з бази даних GenBank. Так для створення видоспецифічних праймерів (Табл.1) до Lactobacillus casei, Lactobacillus salivarius, Bifidobacterium adolescentis та Bifidobacterium bifidum було вибрано ділянку dnaA (1..1500). Даний ген кодує білок ініціації реплікації хромосоми та характеризується високою видоспецифічністю, присутній у всіх штамах та не має повторів в геномі. Це дозволяє точно аналізувати кількість клітин бактерій вказаних видів в зразку.

Для створення видоспецифічних праймерів (Табл.1) до Bifidobacterium longum subsp. infantis було вибрано ділянку гену β-галактозідази (400500..402500). Відсутність повторів цього гену в бактеріальному геномі дозволяє точно аналізувати кількість клітин Bifidobacterium longum subsp. infantis в зразку.

Порівняльний аналіз вибраних олігонуклеотидних праймерів здійснювали з допомогою програми Blast (http://www.ncbi.nlm.nih.gov/blast) для виключення фрагментів, гомологічних до ДНК споріднених та неспоріднених видів. Даний аналіз проводився за повними послідовностями геномів бактерій, доступних в GenBank.

Для ідентифікації всіх інших вказаних видів (Табл.1) було використано праймери, підібрані під час проведення попередніх наших досліджень [5].

Кількісний аналіз складу мультипробіотиків проводили методом «ПЛР-реального часу» за допомогою ампліфікатора ДТ-322 (ДНК-Технологія, Росія). Склад суміші для ПЛР: ПЛР буфер (Amplisens, Росія) – 10 мкл, суміш нуклеотидів – 2,5 мкл, прямий та зворотній праймери – по 1 мкл, Taq-полімераза (Amplisens, Росія) – 2,5 мкл, ДНК – 8 мкл. Візуалізували реакцію додаванням ZUBRgreenI (Білорусь) до ПЛР буфера в кінцевій концентрації 1х. Реакцію проводили за наступною програмою:

  1. 1 цикл:
    94°С – 5хв;
  2. 70 циклів:
    94°С – 15с
    58°С – 30с (знімали флюоресценцію)
    72°С – 1хв 30с;
  3. 1 цикл 72°С – 5хв;
  4. Крива плавлення (з 94°С до 50°С із кроком 1°С та затримкою 45с для зняття флюоресценції);
  5. Зберігання при 10°С.

Таблиця 1. Перелік використаних праймерів та розміри відповідних продуктів ампліфікації для кожного досліджуваного виду, що міститься в мультисимбіозі.

№ п/п Вид Пара праймерів Амплікони (п.н.)
1 B. adolescentis F 5’-GTGGCTGATAACACGACAACAGATCC-3’
R 5’-TTTTGAAGGCGGGGAAGATGTCCT-3’
268
2 B. bifidum F 5’-ACAAGAGCTGGCTTGAAGGAGTCGTA-3’
R 5’-ATGTAGGATTCCTGAGCCAGATCG-3’
304
3 B. breve F 5’-CCGGATGCTCCATCACAC-3’
R 5’-ACAAAGTGCCTTGCTCCCT-3’
288
4 B. longum F 5’-TTTCTATTGAACAGACACAGGTTTGCCC-3’
R 5’-AAACTGATTTGCCGATTTTGCC-3’
268
5 B. longum subsp. infantis F 5’- TGGGGTATTATCAACCCGGC -3’
R 5’- CGTCAACGATTCCAACCACG -3’
284
6 L. acidophilus F 5’-TGCAAAGTGGTAGCGTAAGC-3’
R 5’-CCTTTCCCTCACGGTACTG-3’
207
7 L. brevis F 5’-TTTGACGATCACGAAGTGACCG-3’
R 5’-GCCTTGAGAGATGGTCCTC-3’
495
8 L. casei F 5’-GAAACGTGGACCTGCTGTTG-3’
R 5’-CAGCATCGGCTTTATTCCGC-3’
258
9 L. fermentum F 5’-AAGAATCAGGTAGTCGAAGTG-3’
R 5’-GCCTTGAGAGATGGTCCTC-3’
147
10 L. helveticus F 5’-GAAGTGATGGAGAGTAGAGATA-3’
R 5’-CTCTTCTCGGTCGCCTTG-3’
179 та 429
11 L. gasseri F 5’-GAGTGCGAGAGCACTAAAG-3’
R 5’-CTATTTCAAGTTGAGTTTCTCT-3’
198 та 423
12 L. plantarum F 5’-GCCGCCTAAGGTGGGACAGAT-3’
5’-TTACCTAACGGTAAATGCGA-3’
283 та 512
13 L. salivarius F 5’- TTCTCGCTTTAAATGGGGGCT -3’
R 5’- GCTGGATTTGCCACTGACTTT -3’
271
14 L. lactis F 5’-GTACTTGTACCGACTGGA-3’
R 5’- GGGATCATCTTTGAGTGAT-3’
163
15 P. acidopropionici F 5’-CTGGAAGCTGGCCGTCG-3’
R 5’-CTTGCAACACAACACATTAC-3’
304
16 P. freudenreichii ssp. shermanii F 5’- GACTCGGGCTACAGACAGTG -3’
R 5’- TTCTCGCGCGTGTAGTCATT -3’
171
17 S. salivarius subsp. thermophilus F 5’-CACTATGCTCAGAATACA-3’
R 5’-CGAACAGCATTGATGTTA-3’
968
18 A. aceti F 5’-TGGTACGGCATTCCGGG-3’
R 5’-ACGCTCAATGGACCACTG-3’
285

Результати та обговорення

При конструюванні полівидових симбіозів та їх дослідженні важливу роль відіграє наявність коректного методу визначення якісного та кількісного складу таких багатокомпонентних культур. Особливу актуальність це питання набуває для контролю виробництва мультипробіотиків та пробіотичних продуктів, що містять широкий видовий спектр бактерій із заявленим пробіотичним ефектом. Наші багаторічні дослідження довели, що тісні симбіотичні зв’язки між членами мультикомпонентних пробіотиків значно ускладнюють використання стандартних мікробіологічних методів ідентифікації та оцінки кількості бактерій різних видів, які в багатьох випадках формують на поживних середовищах спільні колонії [2,4,7,8]. Крім того, диференційне культивування та мікроскопія є досить часозатратними методами та не завжди дозволяють провести точний кількісний аналіз та в повній мірі розділити членів стійкого мутуалістичного симбіозу до окремих видів, а тим паче – штамів. Одним із перспективних напрямків вирішення цієї проблеми є використання методів молекулярної біології, зокрема таких як ПЛР та її модифікації.

Як відомо, полімеразна ланцюгова реакція базується на багатократному виборчому копіюванні певної ділянки ДНК за допомогою специфічних ферментів в умовах in vitro [6]. При цьому відбувається копіювання тільки тієї ділянки, яка задовольняє заданим умовам, і лише в тому випадку, якщо вона присутня в досліджуваному зразку, навіть в надзвичайно малих концентраціях. Така вибірковість та специфічність ПЛР досягається завдяки ретельно підібраним праймерам (зазвичай короткі, хімічно синтезовані молекули ДНК довжиною 20-30 нуклеотидних залишків), які обмежують з двох боків послідовність, що розмножується/ копіюється/ ампліфікується. На сьогодні цей метод широко використовується для ідентифікації та детекції видоспецифічних генів. Проте необхідно відмітити, що використання ферментів потребує чіткого підтримання фізичних та хімічних умов для їх ефективного функціювання. Так сама полімеразна ланцюгова реакція є надзвичайно чутливою до впливу широкого класу інгібіторів таких як наприклад іони кальцію, феноли, спирти, полісахариди, деякі білки тощо. Така чутливість ставить певні вимоги не тільки до чистоти власне ДНК яка використовується в дослідженнях, а загалом до самого процесу виділення цієї ДНК.

Мультипробіотики «Симбітер форте», що були використані в даній роботі, є комплексними препаратами з раціональним поєднанням оздоровчих потенціалів живої біомаси пробіотичних бактерій і гелю смектиту глибокого очищення, а також інших біологічно активних продуктів природного походження. Введення гелю смектиту до складу мультипробіотика раціонально доповнює арсенал його властивостей новими фізіологічними активностями і значно збільшує термін зберігання живого пробіотичного препарату за рахунок протекторної дії на анаеробні бактерії [3, 7, 8]. Бактеріальною основою пробіотиків цієї серії є полівидовий симбіоз біфідобактерій видів: Bifidobacterium bifidum, В. longum, В. breve, В. longum ssp. infantis, В. adolescentis, лактобацил видів: Lactobacillus acidophilus, L. casei, L. brevis, L. gasseri, L. helveticus, L. plantarum, L. fermentum, L. salivarius, молочнокислих стрептококів видів: Lactococcus lactis і Streptococcus salivarius ssp. thermophilus, пропіоновокислих бактерій видів: Propionibacterium freudenreichii ssp. shermanii і P. acidipropionici. Як було вказано раніше, дані препарати містять ряд інших біологічно активних речовин природного походження. Так «Симбітер® форте-М» додатково містить суспензію зародків пшениці, «Симбітер® омега» містить масло льону та масло зародків пшениці, а «Симбітер® форте з прополісом» – прополіс [3, 7].

Наявність сорбенту, шроту, жирів та прополісу в складі мультипробіотиків серії «Симбітер® форте» значно ускладнює процеси відмивання бактеріальних клітин та подальшого виділення та очистки ДНК. Крім того, встановлено, що смектит індукує помітне підвищення синтезу екзополісахаридів членами мультисимбіозу.

Таким чином в ході нашої роботи першочерговим завданням було розробити уніфіковану методику відмивання клітин та виділення чистого препарату ДНК, придатного для подальшого проведення ПЛР. Деякі з основних компонентів мультипробіотику можуть ускладнювати виділення ДНК та/або виступати інгібіторами ПЛР. Так, виявилося, що наявність молока та висока кількість полісахаридів, в тому числі асоційованих з клітинною стінкою бактерій, майже унеможливлює розділення клітин та окремих компонентів поживного середовища методом центрифугування. До того ж, високий вміст у складі мультипробіотиків «Симбітер® форте» коротколанцюгових жирних кислот сприяє тому, що казеїн випадає в нерозчинний осад. Переведення білків молока в розчинну форму проводили шляхом підвищення рН до 8,5-9,5. Надалі іони кальцію зв’язували за допомогою EDTA та доводили рівень рН зразка до 8,0.

Відмита таким чином маса бактеріальних клітин характеризується високим вмістом полісахаридів, що ускладнює як подальший лізис клітин, так і виділення ДНК. Так в ході попередніх досліджень вона майже завжди виділялась у суміші з цими полісахаридами, унеможливлюючи проведення ПЛР. Проблему вдалося вирішити проведенням додаткової обробки зразку лізоцимом, який ферментативно відділив полісахариди від клітинної стінки, а подальше центрифугування вже дозволило відокремити бактеріальні клітини. Варто зазначити, що в ході подальшого виділення ДНК із бактеріальних клітин бажаним, проте не обов’язковим, є додаткова очистка лізату хлороформом від залишків білків (в тому числі власне лізоциму) та полісахаридів. Очищену ДНК в подальшому використовували для якісної та кількісної оцінки бактеріального складу мультипробіотичних препаратів.

Існують способи ідентифікації представників родів Bifidobacterium Lactobacillus, Propionibacterium, Lactococcus, Streptococcus та Acetobacter методами ПЛР. Вони базуються в основному на ампліфікації специфічних ділянок кластеру генів які кодують 5S, 16S, 23S субодиниці бактеріальної рибосоми, спейсери між ними та ген lacZ [9-14]. Висока консервативність рибосомального кластеру генів дозволила розробити праймера для ідентифікації не тільки окремих видів та підвидів, але й загалом родів пробіотичних бактерій. В той же час така консервативність може спричинювати появи хибно-позитивних результатів для деяких штамів, а різна копійність цих генів не тільки у різних видів, але й у різних штамів ускладнює їх використання для достовірного аналізу кількості бактеріальних клітин в дослідних зразках.

Раніше нами було запропоновано спосіб визначення наявності ДНК пробіотичних бактерій родів Bifidobacterium Lactobacillus, Propionibacterium, Lactococcus, Streptococcus и Acetobacter, який базується на полімеразній ланцюговій реакції, використовуючи праймера до ділянки одного з генів рибосомального оперону, що кодує синтез 16S субчастинки рибосомальної РНК [15]. До недоліків вказаного способу слід віднести високу консервативність гену 16S рРНК, що може ускладнювати процес видової ідентифікації та точну кількісну оцінку бактеріального складу.

Генотипи Bifidobacterium longum subsp. longum та Bifidobacterium longum subsp. infantis є високогомологічними [16]. Це майже унеможливлює використання високо консервативних генів рибосомального оперону в якості мішеней для ідентифікації методом ПЛР. Ідентифікація бактерій видів Lactobacillus casei, Lactobacillus salivarius, Bifidobacterium adolescentis та Bifidobacterium bifidum за допомогою праймерів, запропонованих в літературі, також була малоефективною, особливо для кількісного аналізу. Тому для вищевказаних видів бактерій нами було спроектовано та синтезовано відповідні пари специфічних праймерів (детальніше див. методи та табл.1).

Результати «ПЛР – реального часу» для «Симбітер® форте-М», «Симбітер® омега» та «Симбітер® форте з прополісом» наведено на рисунках 1, 2 та 3, відповідно. На малюнках представлено графік залежності рівня флюоресценції від циклу (А) та графік кривої плавлення продуктів ампліфікації (Б). Полімеразна ланцюгова реакція для всіх зразків проходить успішно з достатнім рівнем ефективності. Запропонований нами метод отримання ДНК із вказаних зразків дозволяє уніфікувати подібні дослідження та характеризується високим рівнем повторюваності, відповідаючи основним вимогам проведення регулярних якісних та кількісних аналізів вмісту компонентів мультисимбіозів в зразках із високим вмістом інгібіторів ПЛР. Варто відмітити, що у випадку «Симбітер® омега» спостерігались дещо гірші рівні ефективності ПЛР (рис.2), що можна пояснити наявністю олії в зразках. Проте результати отримані для цього препарату є достовірними та так само характеризуються високим рівнем повторюваності в ході повторних експериментів.

Кількісний розрахунок вмісту окремих членів мультисимбіозів в досліджених зразках проводили з використанням розроблених нами раніше методів [5]. Результати отримані методом ПЛР в повній мірі узгоджувались із даними, отриманими мікробіологічними методами дослідження.

Таким чином в ході нашої роботи було розроблено спосіб якісного та кількісного визначення видового складу мультикомпонентного пробіотика, що містить представників 18 видів бактерій родів Bifidobacterium, Lactobacillus, Propionibacterium, Lactococcus, Streptococcus та Acetobacter за допомогою специфічних праймерів методом полімеразної ланцюгової реакції в режимі реального часу. Даний метод дозволяє проводити швидку та точну оцінку зразків в умовах присутності різноманітних інгібіторів полімеразної ланцюгової реакції.



Рис.1 Результати «ПЛР – реального часу» для «Симбітер® форте-М».
А – графік залежності рівня флюоресценції від циклу.
Б – крива плавлення продуктів ампліфікації (графік залежності швидкості зміни рівня флюоресценції від температури).


Рис.2 Результати «ПЛР – реального часу» для «Симбітер® омега»


Рис.3 Результати «ПЛР – реального часу» для «Симбітер® форте з прополісом»

Резюме

Важливу роль у розробці та дослідженні багатокомпонентних пробіотиків відіграють методи визначення їх якісного та кількісного складу. Як таксономічна ідентифікація, так і кількісний аналіз компонентів таких мультисимбіозів можуть бути значно прискорені із застосуванням сучасних методів, заснованих на виявленні та ідентифікації послідовностей ДНК за допомогою полімеразної ланцюгової реакції (ПЛР). Однією з основних вимог до даного методу є чистота виділеної ДНК та відсутність інгібіторів полімеразної ланцюгової реакції в її вмісті.

В ході нашої роботи ми розробили метод використання полімеразної ланцюгової реакції в реальному часі для якісного та кількісного визначення видового складу в багатокомпонентних пробіотичних препаратах, що містять представників 18 видів родів Bifidobacterium, Lactobacillus, Propionibacterium, Lactococcus, Streptococcus та Acetobacter. Цей метод дозволяє швидко і точно досліджувати зразки в присутності різних інгібіторів полімеразної ланцюгової реакції.

Ключові слова: полімеразна ланцюгова реакція реального часу, ДНК, мультикомпонентні пробіотики, мікроорганизм

Література

  1. Schrader C., Schielke A., Ellerbroek L., Johne R. PCR inhibitors–occurrence, properties and removal. Journal of applied microbiology. 2012;113(5):1014–26.
  2. Shirobokov V.P., Yankovsky D.S., Dyment G.S. Perspective of using bentonite on creation of a new type of multiprobiotics. „Sovriemennaia pediatria”. 2008;4(21):143-154.
  3. Shirobokov V.P., Yankovsky D.S., Dyment G.S. The method of making probiotic Symbiter forte. Patent № 34782 Ukraine А61К35/74, А23С9/12, С12N1/20. Application 07.03.2008, published 26.08.2008, Bulletin №16.
  4. Shirobokov V.P., Yankovsky D.S., Dyment G.S. Microbes in biogeochemical processes, biosphere evolution, and existence of humankind. Кyiv:FОP Veres О.I.;2014
  5. Kitam V.O., Litovchenko O.V., Korobka V.L., Shevchenko L.M., Shevchenko T.V., Yankovskiy D.S., Dyment G.S., vynakhidnyky; TOV firma “O.D. Prolisok”, patentovlasnyk. Sposib yakisnogo ta kilkisnogo vyznachennya vydovogo skladu bagatokomponentnyh bakterialnyh preparative za dopomogoyu specyfichnyh praymeriv metodom polimeraznoi lancyugovoi reakciy realnogo chasu. Patent Ukrainy № 115774. 2017 Kvi 25.
  6. Saiki R.K., Gelfand D.H., Stoffel S, Scharf S.J., Higuchi R, Horn G.T., Mullis K.B., Erlich H.A. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 1988;239:487-491.
  7. Shirobokov V.P., Yankovsky D.S., Dyment G.S. Creation of health-improving agents of new generation on basis of smectite. Vrachebnoie delo 2015;1/2:3-9.
  8. Yankovsky D.S., Shirobokov V.P., Dyment G.S. Integral role of symbiotic microflora in human physiology. Kyiv:Limited company „Chervona Ruta -Турс”;2011.
  9. Hyuk-Sang Kwon, Eun-Hee Yang, Seung-Hun Lee, Seung-Woo Yeon, Byung-Hwa Kang, Tae-Yong Kim. Rapid identification of potentially probiotic Bifidobacterium species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA. FEMS Microbiology Letters. 2005; 250(1):55-62
  10. Markiewicz L., Biedrzycka E. Identification of Lactobacillus and Bifidobacterium species with PCR applied to quality control of fermented dairy beverages. Pol. J. Food Nutr. Sci. 2005; 14/55(4):359–365.
  11. Tokunaga H., Tanaka H., Hashiguchi K., Nagano M., Arakawa T., Tokunaga M. Rapid detection of acetic acid bacteria in the traditional pot-fermented rice vinegar Kurozu. Food Sci. Technol. Res. 2009; 15(6): 587–590.
  12. Lick S., Keller M., Bockelmann W., Heller K. J. Rapid identification of Streptococcus thermophilus by primer-specific PCR amplification based on its lacZ gene. System. Appl. Microbiol. 1996;19: 74–77.
  13. Blajotta G., Pepe O., Mauriello G., Villani F., Andolfi R. 16S–23S rDNA inter-genic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis. System. Appl. Microbiol. 2002;25: 520–527.
  14. Tilsala-Timisjärvi A., Alatossava T. Caracterization of the 16S–23S and 23S–5S rRNA intergenic spacer regions of dairy propionibacteria and their identification with species-specific primers by PCR. Int. J. Food Microbiol. 2001; 68: 45–52.
  15. Yankovsky D.S., Zaets V.N., Zvarych V.А., KItam V.О., Dyment G.S. Using Polymerase chain reaction for identifying bacterial content of multicomponent probiotics. Sovremennaia prdiatria. 2012;6(46): 65-68.
  16. Šrůtková D., Španova A., Špano M., Dráb V., Schwarzer M., Kozaková H., et al. Efficiency of PCR-based methods in discriminating Bifidobacterium longum ssp. longum and Bifidobacterium longum ssp. infantis strains of human origin. Journal of Microbiological Methods. 2011;87(1):6–10.