Использование метода полимеразной цепной реакции реального времени для оценки таксономического состава мультикомпонентных пробиотиков

pcr

В.А. Китам, Д.С. Янковский, В.П. Широбоков, Г.С. Дымент, А.В. Литовченко, Л. Шевченко, Т.В. Шевченко

Введение

Создание и производство мультикомпонентных пробиотиков требует постоянного качественного и количественного контроля их состава. Стандартные микробиологические подходы, такие как выделение отдельных культур и идентификация их таксономического положения на основе изучения морфологических и биохимических свойств не всегда дают возможность точно оценить содержание представителей различных микробных таксонов в составе мультисимбиоза. Кроме того, такие методы являются в значительной степени время- и трудозатратными. Использование современных методов, основанных на детекции и идентификации последовательностей ДНК с использованием полимеразной цепной реакции (ПЦР), а особенно ее модификации — количественной полимеразной цепной реакции в реальном времени (ПЦР-РВ) позволяет значительно ускорить не только таксономическую идентификацию, но и количественный анализ составляющих мультисимбиозов.

Одним из условий проведения точной количественной оценки микробиологического состава различных кисломолочных продуктов, а также мультисимбиозов, культивируемых на молокосодержащих питательных средах, является чистота выделенной ДНК и отсутствие в ней ингибиторов полимеразной цепной реакции. Так, наличие в образцах протеаз, ионов кальция (Ca2+) и различных полисахаридов [1] значительно усложняет, а иногда и делает невозможным проведение реакции.

Недавно авторами разработана новая серия мультикомпонентных пробиотиков «Симбитер® форте», содержащих кроме пробиотической биомассы гель смектит (бентонит) [2-4]. Высокая адсорбционная активность смектита является дополнительным фактором, затрудняющим реализацию метода.

В ходе работы нами была разработана методика качественной и количественной оценки таксономического состава мультикомпонентных симбиозов пробиотических бактерий, составляющих основу поливидовых пробиотиков, в том числе мультипробиотиков «Симбитер® форте-М» (https://symbiter.ua/ru/multiprobiotics-symbiter-ru/symbiter-forte-m.html), «Симбитер® форте омега» (https://symbiter.ua/ru/multiprobiotics-symbiter-ru/symbiter-forte-omega.html) и «Симбитер® форте с прополисом» (https://symbiter.ua/ru/multiprobiotics-symbiter-ru/symbiter-forte-with-propolis.html) (производитель НПК «О.Д. Пролисок»). Для этого был модифицирован метод выделения и очистки ДНК из бактериальных клеток с учетом высокого содержания полисахаридов, смектита и других ингибиторов ПЦР в образцах, а также разработан метод количественной оценки видового состава мультипробиотиков методом «ПЦР-реального времени» [6].

Материалы и методы

Для выделения ДНК бактериальные клетки предварительно отмывали от остатков казеина, ионов кальция, смектита и экзополисахаридов. Для этого содержимое одного пакета/саше мультипробиотиков разводили в соотношении 2:3 0.1н раствором NaOH и отбирали 450 мкл образца с последующим центрифугированием в течение 10 мин при 10 тыс. об/мин. (MiniSpin Eppendorf, Германия). В дальнейшем полученный осадок разводили в 0,5 мл ТЕ-буфера (рН 8,0) и так же центрифугировали. Отмытый осадок снова разводили 250 мкл ТЕ-буфера (рН 8,0) с добавлением лизоцима в соотношении 5 мкг на 1 мл буфера и инкубировали в термостате 1 час при 37°С. Лизис бактериальных клеток проводили добавляя 0,5 мл лизисного буфера BQ1 (Macherey-Nagel, Германия) и инкубируя в термостате 1час при 70 ° С. В дальнейшем добавляли к пробиркам равный объем хлороформа и оставляли на 15 мин, время от времени мягко перемешивая. Распределение фаз проводили центрифугированием 10 мин при 10 тыс. об/мин. Верхнюю прозрачную фазу осторожно отбирали в чистую пробирку, добавляли равный объем изопропанола, тщательно перемешивали, инкубировали 15 мин. при комнатной температуре и центрифугировали 10 мин. при 10 тыс. об/мин. Осадок последовательно промывали с помощью 100% и 70% растворов этилового спирта соответственно, центрифугируя 10 мин. при 10 тыс. об/мин. Промытый осадок в дальнейшем высушивали и хранили при -20 ° С, разводя в 200 мкл ТЕ-буфера непосредственно перед анализом.

Праймеры подбирали с помощью программы PrimerBlast (http://www.ncbi.nlm.nih.gov/tools/primer-blast) согласно правилам молекулярного дизайна, основываясь на данных полного секвенирования геномов, взятых из базы данных GenBank. Так для создания видоспецифических праймеров (табл.1) до Lactobacillus casei, Lactobacillus salivarius, Bifidobacterium adolescentis и Bifidobacterium bifidum было выбрано участок dnaA (1..1500). Данный ген кодирует белок инициации репликации хромосомы и характеризуется высокой видоспецифичностью, присутствует во всех штаммах и не имеет повторов в геноме. Это позволяет точно анализировать количество клеток бактерий указанных видов в образце.

Для создания видоспецифических праймеров (табл.1) до Bifidobacterium longum subsp. infantis было выбрано участок гена β-галактозидазы (400500..402500). Отсутствие повторов этого гена в бактериальном геноме позволяет точно анализировать количество клеток Bifidobacterium longum subsp. infantis в образце.

Сравнительный анализ выбранных олигонуклеотидных праймеров осуществляли с помощью программы Blast (http://www.ncbi.nlm.nih.gov/blast) для исключения фрагментов, гомологичных к ДНК родственных и неродственных видов. Данный анализ проводился по полным последовательностям геномов бактерий, доступных в GenBank.

Для идентификации всех остальных указанных видов (табл.1) были использованы праймеры, подобранные во время проведения предыдущих наших исследований [5].
Количественный анализ состава мультипробиотиков проводили методом «ПЦР-реального времени» с помощью амплификатора ДТ-322 (ДНК-Технология, Россия). Состав смеси для ПЦР: ПЦР буфер (Amplisens, Россия) — 10 мкл, смесь нуклеотидов — 2,5 мкл, прямой и обратной праймеры — по 1 мкл, Taq-полимераза (Amplisens, Россия) — 2,5 мкл, ДНК — 8 мкл. Визуализировали реакцию добавлением ZUBRgreenI (Беларусь) в ПЦР буфера в конечной концентрации 1х. Реакцию проводили по следующей программе:

  1. 1 цикл: 94 ° С — 5 мин;
  2. 70 циклов: 94 ° С — 15 с
    58 ° С — 30 с (снимали флюоресценцию)
    72 ° С — 1 мин 30 с;
  3. 1 цикл 72 ° С — 5 мин;
  4. Кривая плавления (с 94 ° С до 50 ° С с шагом 1 ° С и задержкой 45 с для снятия флюоресценции)
  5.  Хранение при 10 ° С.

Таблица 1. Перечень использованных праймеров и размеры соответствующих продуктов амплификации для каждого исследуемого вида, содержащегося в мультисимбиозе.

№ п/п Вид Пара праймеров Ампликоны (п.н.)
1 B. adolescentis F 5’-GTGGCTGATAACACGACAACAGATCC-3’
R 5’-TTTTGAAGGCGGGGAAGATGTCCT-3’
268
2 B. bifidum F 5’-ACAAGAGCTGGCTTGAAGGAGTCGTA-3’
R 5’-ATGTAGGATTCCTGAGCCAGATCG-3’
304
3 B. breve F 5’-CCGGATGCTCCATCACAC-3’
R 5’-ACAAAGTGCCTTGCTCCCT-3’
288
4 B. longum F 5’-TTTCTATTGAACAGACACAGGTTTGCCC-3’
R 5’-AAACTGATTTGCCGATTTTGCC-3’
268
5 B. longum subsp. infantis F 5’- TGGGGTATTATCAACCCGGC -3’
R 5’- CGTCAACGATTCCAACCACG -3’
284
6 L. acidophilus F 5’-TGCAAAGTGGTAGCGTAAGC-3’
R 5’-CCTTTCCCTCACGGTACTG-3’
207
7 L. brevis F 5’-TTTGACGATCACGAAGTGACCG-3’
R 5’-GCCTTGAGAGATGGTCCTC-3’
495
8 L. casei F 5’-GAAACGTGGACCTGCTGTTG-3’
R 5’-CAGCATCGGCTTTATTCCGC-3’
258
9 L. fermentum F 5’-AAGAATCAGGTAGTCGAAGTG-3’
R 5’-GCCTTGAGAGATGGTCCTC-3’
147
10 L. helveticus F 5’-GAAGTGATGGAGAGTAGAGATA-3’
R 5’-CTCTTCTCGGTCGCCTTG-3’
179 та 429
11 L. gasseri F 5’-GAGTGCGAGAGCACTAAAG-3’
R 5’-CTATTTCAAGTTGAGTTTCTCT-3’
198 та 423
12 L. plantarum F 5’-GCCGCCTAAGGTGGGACAGAT-3’
5’-TTACCTAACGGTAAATGCGA-3’
283 та 512
13 L. salivarius F 5’- TTCTCGCTTTAAATGGGGGCT -3’
R 5’- GCTGGATTTGCCACTGACTTT -3’
271
14 L. lactis F 5’-GTACTTGTACCGACTGGA-3’
R 5’- GGGATCATCTTTGAGTGAT-3’
163
15 P. acidopropionici F 5’-CTGGAAGCTGGCCGTCG-3’
R 5’-CTTGCAACACAACACATTAC-3’
304
16 P. freudenreichii ssp. shermanii F 5’- GACTCGGGCTACAGACAGTG -3’
R 5’- TTCTCGCGCGTGTAGTCATT -3’
171
17 S. salivarius subsp. thermophilus F 5’-CACTATGCTCAGAATACA-3’
R 5’-CGAACAGCATTGATGTTA-3’
968
18 A. aceti F 5’-TGGTACGGCATTCCGGG-3’
R 5’-ACGCTCAATGGACCACTG-3’
285

Результаты и обсуждение

При конструировании поливидовых симбиозов и их исследовании важную роль играет наличие корректного метода определения качественного и количественного состава таких многокомпонентных культур. Особую актуальность этот вопрос приобретает для контроля производства мультипробиотиков и пробиотических продуктов, содержащих широкий видовой спектр бактерий с заявленным пробиотическим эффектом. Наши многолетние исследования показали, что тесные симбиотические связи между членами мультикомпонентных пробиотиков значительно затрудняют использование стандартных микробиологических методов идентификации и оценки количества бактерий разных видов, которые во многих случаях формируют на питательных средах совместные колонии [2,4,7,8]. Кроме того, дифференциальное культивирование и микроскопия достаточно времязатратные методы и не всегда позволяют провести точный количественный анализ и в полной мере разделить членов устойчивого мутуалистического симбиоза к отдельным видам, а тем более — штаммов. Одним из перспективных направлений решения этой проблемы является использование методов молекулярной биологии, в частности таких как ПЦР и ее модификации.

Как известно, полимеразная цепная реакция базируется на многократном избирательном копировании определенного участка ДНК с помощью специфических ферментов в условиях in vitro [6]. При этом происходит копирование только того участка, который удовлетворяет заданным условиям, и только в том случае, если он присутствует в исследуемом образце, даже в чрезвычайно малых концентрациях. Такая избирательность и специфичность ПЦР достигается благодаря тщательно подобранным праймерам (обычно короткие, химически синтезированные молекулы ДНК длиной 20-30 нуклеотидных остатков), которые ограничивают с двух сторон последовательность, которая размножается/копируется/амплифицируется. Сегодня этот метод широко используется для идентификации и детекции видоспецифических генов. Однако необходимо отметить, что использование ферментов требует четкого поддержания физических и химических условий для их эффективного функционирования. Так же полимеразная цепная реакция является чрезвычайно чувствительной к воздействию широкого класса ингибиторов, таких, как например ионы кальция, фенолы, спирты, полисахариды, некоторые белки и тому подобное. Такая чувствительность ставит определенные требования не только к чистоте собственно ДНК, которая используется в исследованиях, а в целом к самому процессу выделения этой ДНК.

Мультипробиотики «Симбитер® форте», которые были использованы в данной работе, являются комплексными препаратами с рациональным сочетанием оздоровительных потенциалов живой биомассы пробиотических бактерий и геля смектита глубокой очистки, а также других биологически активных продуктов природного происхождения. Введение геля смектита в состав мультипробиотика рационально дополняет арсенал его свойств новыми физиологическими активностями и значительно увеличивает срок хранения живого пробиотического препарата за счет протекторного действия на анаэробные бактерии [3, 7, 8]. Бактериальной основой пробиотиков этой серии является поливидовой симбиоз бифидобактерий видов: Bifidobacterium bifidum, В. longum, В. breve, В. longum ssp. infantis, В. adolescentis, лактобацилл видов: Lactobacillus acidophilus, L. casei, L. brevis, L. gasseri, L. helveticus, L. plantarum, L. fermentum, L. salivarius, молочнокислых стрептококков видов: Lactococcus lactis и Streptococcus salivarius ssp . thermophilus, пропионовокислых бактерий видов: Propionibacterium freudenreichii ssp. shermanii и P. acidipropionici. Как было указано ранее, данные препараты содержат ряд других биологически активных веществ природного происхождения. Так «Симбитер® форте-М» дополнительно содержит суспензию зародышей пшеницы, «Симбитер® омега» содержит масло льна и масло зародышей пшеницы, а «Симбитер® форте с прополисом» — прополис [3, 7].

Наличие сорбента, шрота, жиров и прополиса в составе мультипробиотиков серии «Симбитер® форте» значительно усложняет процессы отмывания бактериальных клеток и последующего выделения и очистки ДНК. Кроме того, установлено, что смектит индуцирует заметное повышение синтеза экзополисахаридов членами мультисимбиоза.

Таким образом в ходе нашей работы первоочередной задачей было разработать унифицированную методику отмывания клеток и выделения чистого препарата ДНК, пригодного для дальнейшего проведения ПЦР. Некоторые из основных компонентов мультипробиотиков могут затруднять выделение ДНК и/или выступать ингибиторами ПЦР. Так, оказалось, что наличие молока и высокое количество полисахаридов, в том числе ассоциированных с клеточной стенкой бактерий, почти исключает разделение клеток и отдельных компонентов питательной среды методом центрифугирования. К тому же высокое содержание в составе мультипробиотиков «Симбитер® форте» короткоцепочечных жирных кислот способствует тому, что казеин выпадает в нерастворимый осадок. Перевод белков молока в растворимую форму проводили путем повышения рН до 8,5-9,5. В дальнейшем ионы кальция связывали с помощью EDTA и доводили уровень рН образца до 8,0.

Отмытая таким образом масса бактериальных клеток характеризуется высоким содержанием полисахаридов, что затрудняет как дальнейший лизис клеток, так и выделение ДНК. Так в ходе предыдущих исследований она почти всегда выделялась в смеси с этими полисахаридами, исключая проведение ПЦР. Проблему удалось решить проведением дополнительной обработки образца лизоцима, который ферментативно отделил полисахариды от клеточной стенки, а дальнейшее центрифугирование уже позволило отделить бактериальные клетки. Стоит отметить, что в ходе дальнейшего выделения ДНК из бактериальных клеток желательной, однако не обязательной, является дополнительная очистка лизата хлороформом от остатков белков (в том числе собственно лизоцима) и полисахаридов. Очищенную ДНК в дальнейшем использовали для качественной и количественной оценки бактериального состава мультипробиотических препаратов.

Существуют способы идентификации представителей родов Bifidobacterium Lactobacillus, Propionibacterium, Lactococcus, Streptococcus и Acetobacter методами ПЦР. Они базируются в основном на амплификации специфических участков кластера генов кодирующих 5S, 16S, 23S субъединицы бактериальной рибосомы, спейсеры между ними и ген lacZ [9-14]. Высокая консервативность рибосомального кластера генов позволила разработать праймеры для идентификации не только отдельных видов и подвидов, но и в целом родов пробиотических бактерий. В то же время такая консервативность может вызвать появление ложноположительных результатов для некоторых штаммов, а разная копийность этих генов не только у разных видов, но и разных штаммов затрудняет их использование для достоверного анализа количества бактериальных клеток в опытных образцах.

Ранее нами был предложен способ определения наличия ДНК пробиотических бактерий родов Bifidobacterium, Lactobacillus, Propionibacterium, Lactococcus, Streptococcus и Acetobacter, основанный на полимеразной цепной реакции, используя праймеры к участку одного из генов рибосомального оперона, кодирующего синтез 16S субчастицы рибосомальной РНК [15]. К недостаткам указанного способа следует отнести высокую консервативность гена 16S рРНК, что может затруднять процесс видовой идентификации и точную количественную оценку бактериального состава.

Генотипы Bifidobacterium longum subsp. longum и Bifidobacterium longum subsp. infantis являются высокогомологичными [16]. Это почти исключает использование высоко консервативных генов рибосомального оперона в качестве мишеней для идентификации методом ПЦР. Идентификация бактерий видов Lactobacillus casei, Lactobacillus salivarius, Bifidobacterium adolescentis и Bifidobacterium bifidum с помощью праймеров, предложенных в литературе, также была малоэффективной, особенно для количественного анализа. Поэтому для вышеуказанных видов бактерий нами были спроектированы и синтезированы соответствующие пары специфических праймеров (подробнее см. Методы и табл.1).

Результаты «ПЦР — реального времени» для «Симбитер® форте-М», «Симбитер® омега» и «Симбитер® форте с прополисом» приведены на рисунках 1, 2 и 3, соответственно. На рисунках представлены график зависимости уровня флюоресценции от цикла (А) и график кривой плавления продуктов амплификации (Б). Полимеразная цепная реакция для всех образцов проходит успешно с достаточным уровнем эффективности. Предложенный нами метод получения ДНК из указанных образцов позволяет унифицировать подобные исследования и характеризуется высоким уровнем повторяемости, отвечая основным требованиям проведения регулярных качественных и количественных анализов содержания компонентов мультисимбиозов в образцах с высоким содержанием ингибиторов ПЦР. Стоит отметить, что в случае «Симбитер® омега» наблюдались несколько худшие уровни эффективности ПЦР (рис.2), что можно объяснить наличием масла в образцах. Однако результаты, полученные для этого препарата, являются достоверными и так же характеризуются высоким уровнем повторяемости в ходе повторных экспериментов.

Количественный расчет содержания отдельных членов мультисимбиозов в исследованных образцах проводили с использованием разработанных нами ранее методов [5]. Результаты, полученные методом ПЦР, в полной мере согласовывались с данными, полученными микробиологическими методами исследования.

Таким образом в ходе нашей работы был разработан способ качественного и количественного определения видового состава мультикомпонентного пробиотика, содержащего представителей 18 видов бактерий родов Bifidobacterium, Lactobacillus, Propionibacterium, Lactococcus, Streptococcus и Acetobacter с помощью специфических праймеров методом полимеразной цепной реакции в режиме реального времени. Данный метод позволяет проводить быструю и точную оценку образцов в условиях присутствия различных ингибиторов полимеразной цепной реакции.



Рис.1 Результаты «ПЦР — реального времени» для «Симбитер® форте-М».
А — график зависимости уровня флюоресценции от цикла.
Б — кривая плавления продуктов амплификации (график зависимости скорости изменения уровня флюоресценции от температуры).


Рис.2 Результаты «ПЛР — реального времени» для «Симбитер® омега»


Рис.3 Результаты «ПЛР — реального времени» для «Симбитер® форте с прополисом»

Резюме

Важную роль в разработке и исследовании многокомпонентных пробиотиков играют методы определения их качественного и количественного состава. Как таксономическая идентификация, так и количественный анализ компонентов таких мультисимбиозов могут быть значительно ускорены с применением современных методов, основанных на выявлении и идентификации последовательностей ДНК с помощью полимеразной цепной реакции (ПЦР). Одним из основных требований к данному методу является чистота выделенной ДНК и отсутствие ингибиторов полимеразной цепной реакции в ее содержании.

В ходе нашей работы мы разработали метод использования полимеразной цепной реакции в реальном времени для качественного и количественного определения видового состава в многокомпонентных пробиотических препаратах, содержащих представителей 18 видов родов Bifidobacterium, Lactobacillus, Propionibacterium, Lactococcus, Streptococcus и Acetobacter. Этот метод позволяет быстро и точно исследовать образцы в присутствии различных ингибиторов полимеразной цепной реакции.

Ключевые слова: полимеразная цепная реакция реального времени, ДНК, мультикомпонентные пробиотики, микроорганизм

Литература

  1. Schrader C., Schielke A., Ellerbroek L., Johne R. PCR inhibitors–occurrence, properties and removal. Journal of applied microbiology. 2012;113(5):1014–26.
  2. Shirobokov V.P., Yankovsky D.S., Dyment G.S. Perspective of using bentonite on creation of a new type of multiprobiotics. „Sovriemennaia pediatria”. 2008;4(21):143-154.
  3. Shirobokov V.P., Yankovsky D.S., Dyment G.S. The method of making probiotic Symbiter forte. Patent № 34782 Ukraine А61К35/74, А23С9/12, С12N1/20. Application 07.03.2008, published 26.08.2008, Bulletin №16.
  4. Shirobokov V.P., Yankovsky D.S., Dyment G.S. Microbes in biogeochemical processes, biosphere evolution, and existence of humankind. Кyiv:FОP Veres О.I.;2014
  5. Kitam V.O., Litovchenko O.V., Korobka V.L., Shevchenko L.M., Shevchenko T.V., Yankovskiy D.S., Dyment G.S., vynakhidnyky; TOV firma “O.D. Prolisok”, patentovlasnyk. Sposib yakisnogo ta kilkisnogo vyznachennya vydovogo skladu bagatokomponentnyh bakterialnyh preparative za dopomogoyu specyfichnyh praymeriv metodom polimeraznoi lancyugovoi reakciy realnogo chasu. Patent Ukrainy № 115774. 2017 Kvi 25.
  6. Saiki R.K., Gelfand D.H., Stoffel S, Scharf S.J., Higuchi R, Horn G.T., Mullis K.B., Erlich H.A. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 1988;239:487-491.
  7. Shirobokov V.P., Yankovsky D.S., Dyment G.S. Creation of health-improving agents of new generation on basis of smectite. Vrachebnoie delo 2015;1/2:3-9.
  8. Yankovsky D.S., Shirobokov V.P., Dyment G.S. Integral role of symbiotic microflora in human physiology. Kyiv:Limited company „Chervona Ruta -Турс”;2011.
  9. Hyuk-Sang Kwon, Eun-Hee Yang, Seung-Hun Lee, Seung-Woo Yeon, Byung-Hwa Kang, Tae-Yong Kim. Rapid identification of potentially probiotic Bifidobacterium species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA. FEMS Microbiology Letters. 2005; 250(1):55-62
  10. Markiewicz L., Biedrzycka E. Identification of Lactobacillus and Bifidobacterium species with PCR applied to quality control of fermented dairy beverages. Pol. J. Food Nutr. Sci. 2005; 14/55(4):359–365.
  11. Tokunaga H., Tanaka H., Hashiguchi K., Nagano M., Arakawa T., Tokunaga M. Rapid detection of acetic acid bacteria in the traditional pot-fermented rice vinegar Kurozu. Food Sci. Technol. Res. 2009; 15(6): 587–590.
  12. Lick S., Keller M., Bockelmann W., Heller K. J. Rapid identification of Streptococcus thermophilus by primer-specific PCR amplification based on its lacZ gene. System. Appl. Microbiol. 1996;19: 74–77.
  13. Blajotta G., Pepe O., Mauriello G., Villani F., Andolfi R. 16S–23S rDNA inter-genic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis. System. Appl. Microbiol. 2002;25: 520–527.
  14. Tilsala-Timisjärvi A., Alatossava T. Caracterization of the 16S–23S and 23S–5S rRNA intergenic spacer regions of dairy propionibacteria and their identification with species-specific primers by PCR. Int. J. Food Microbiol. 2001; 68: 45–52.
  15. Yankovsky D.S., Zaets V.N., Zvarych V.А., KItam V.О., Dyment G.S. Using Polymerase chain reaction for identifying bacterial content of multicomponent probiotics. Sovremennaia prdiatria. 2012;6(46): 65-68.
  16. Šrůtková D., Španova A., Špano M., Dráb V., Schwarzer M., Kozaková H., et al. Efficiency of PCR-based methods in discriminating Bifidobacterium longum ssp. longum and Bifidobacterium longum ssp. infantis strains of human origin. Journal of Microbiological Methods. 2011;87(1):6–10.